WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

RNAi :

WormBase ID  WBRNAi00088920 Phenotype Remark  RNAi caused complete embryonic lethality. Most nuclei of dying embryos had two 5S ribosomal DNA (rDNA) fluorescence in situ hybridization (FISH) signals, indicating normal chromosome segregation. Occasional nuclei had more than two FISH signals, perhaps from the premature dissociation of sister chromatids.
Remark  paper remark: Exact sequence used for RNAi not stated by authors, genomic sequence of gene used for curation. Primers used were scc-3 5' GCGTAATACGACTCACTATAGGGTACCGAAACCCTCATCCCTCTCATTCCTCG 3' and 5' GCGTAATACGACTCACTATAGGGATCTTGTCCTGTGCCAATAACTTCCCG.
Paste the following link
Lists
This RNAi isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis elegans 6239

1 Data Sets

Name URL
WormBaseAcedbConverter  

1 Inhibits Gene

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00004738 scc-3 F18E2.3 Caenorhabditis elegans

1 Inhibits Predicted Gene

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:F18E2.3 F18E2.3 3291   V: 12763945-12764042

1 Laboratories

Primary Identifier
TY

1 Phenotype

Identifier Name Description
WBPhenotype:0000050 embryonic lethal Animals die during embryonic development. In C. elegans, often assayed as refractile eggs that fail to hatch; when applied to large-scale RNAi screens in C. elegans, more than 10% of embryos die.

1 Phenotype _ Not _ Observed

Identifier Name Description
WBPhenotype:0000773 chromosome segregation variant Any variation in the processes that regulate the apportionment of chromosomes to each of two daughter cells compared to control.

1 Reference

First Author Title Year Journal Volume Pages PubMed ID
            WBPaper00005919

0 Strain