WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Expression Pattern :

Pattern  Larval Expression: unidentified cells in head; Primary Identifier  Expr7035
Remark  Also expressed in (comments from author) : No comments. Strain: BC10075 Reporter Gene  [Y53C12C.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAGGCAGTTTGTAATTCTCCACA] 3' and primer B 5' [GTGTCGTGGTAAACCGTGAGT] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

1 Anatomy Terms

Definition Name Synonym Primary Identifier
anterior-most body region containing the pharynx. head   WBbt:0005739

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00013147 eyg-1 Y53C12C.1 Caenorhabditis elegans

1 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023