WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: coelomocytes; unidentified cells in head; Larval Expression: coelomocytes; Primary Identifier  Expr6891
Remark  Also expressed in (comments from author) : usually see 2 of the 3 coelomocyte pairs, sometimes only one pair, and sometimes none. Strain: BC14121 Reporter Gene  [Y116A8C.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCGACAGGCTACATGCCTA] 3' and primer B 5' [ATCCCGGAAATTTTGATAGTGTTA] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

2 Anatomy Terms

Definition Name Synonym Primary Identifier
A free-floating spherical cell lying in the pseudocoelomic cavity of larvae and adult C. elegans which can endocytose many compounds, possibly for immune surveillance. There are six coelomocytes in adult hermaphrodites, and they display prominent cytoplasmic inclusions and vacuoles. coelomocyte   WBbt:0005751
anterior-most body region containing the pharynx. head   WBbt:0005739

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00013784 Y116A8C.3 Y116A8C.3 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023