WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Expression Pattern :

Pattern  Larval Expression: body wall muscle; Primary Identifier  Expr6222
Remark  Also expressed in (comments from author) : low intensity GFP. Strain: BC16004 Reporter Gene  [srxa-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTTGCCTTGAGACTCCCAT] 3' and primer B 5' [GATTGGGAAGAGATTTTCAGTTTT] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

1 Anatomy Terms

Definition Name Synonym Primary Identifier
Longitudinal bands of muscle cells surrounding animal body, with one band running in each quadrant of the body, regulated contraction and relaxation of these muscles cause locomotion. body wall musculature body muscle WBbt:0005813

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00010153 srxa-2 F56D5.10 Caenorhabditis elegans

1 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023