WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: arcade cells; Reproductive System; uterus; spermatheca; unidentified cells in head; Larval Expression: arcade cells; Reproductive System; developing uterus; developing spermatheca; hypodermis; unidentified cells in head; Primary Identifier  Expr6347
Remark  Strain: BC14586 Reporter Gene  [tag-218::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATTTATGGGGATGATTGGAGC] 3' and primer B 5' [TTCCGTGTCGGAGATTACAAC] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

6 Anatomy Terms

Definition Name Synonym Primary Identifier
an accordion-like tube that contains sperm and is the site of oocyte fertilization. spermatheca   WBbt:0005319
Epidermal layer. hypodermis epidermis WBbt:0005733
The organ in which the eggs are developed and protected until laid. uterus   WBbt:0006760
Interfacial (hypodermal) cells which connect the hypodermal epithelium of the lips to the pharyngeal epithelium, firmly binding the inner tissue (the pharynx) to the outer bodywall (the hypodermis). arcade cell   WBbt:0005793
anterior-most body region containing the pharynx. head   WBbt:0005739
  reproductive system   WBbt:0005747

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00019487 ephx-1 K07D4.7 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023