WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: unidentified cells; unidentified cells in tail ; Larval Expression: unidentified cells; unidentified cells in tail ; Primary Identifier  Expr6119
Remark  Also expressed in (comments from author) : Embryo incomplete. Will be updated. Strain: BC11529 Reporter Gene  [F48G7.10::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GAGAAATTAAACTTCCCAGCAAAA] 3' and primer B 5' [GTGGCTCGGTGGAGATTG] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

1 Anatomy Terms

Definition Name Synonym Primary Identifier
posterior region, from rectum to the end tail   WBbt:0005741

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00018621 F48G7.10 F48G7.10 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023