WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: Reproductive System; vulval muscle; spermatheca; seam cells; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; amphids; neurons along body; tail neurons; phasmids; Larval Expression: Reproductive System; developing vulva; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; amphids; neurons along body; tail neurons; phasmids; Primary Identifier  Expr6134
Remark  Also expressed in (comments from author) : Pan-neural. Strain: DM12763 Reporter Gene  [F52B5.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GAGGAAAGAACCGATTGGAA] 3' and primer B 5' [ATTGCATCCAGGAGGTTTTG] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

16 Anatomy Terms

Definition Name Synonym Primary Identifier
neuron with cell body associated with the ventral nerve cord. ventral cord neuron ventral cord motoneuron WBbt:0005300
female genital. vulva   WBbt:0006748
an accordion-like tube that contains sperm and is the site of oocyte fertilization. spermatheca   WBbt:0005319
Epidermal layer. hypodermis epidermis WBbt:0005733
muscle associated with hermaphrodite vulva. vulval muscle   WBbt:0005821
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities. nervous system   WBbt:0005735
neuron with its cell body situated in the head, excluding the pharynx. head neuron   WBbt:0006751
neuron with its cell body situated in the tail, posterior to rectum. tail neuron   WBbt:0006759
Major cell type of nervous tissue, specialized for transmission of information in the form of patterns of impulses. neuron neurone WBbt:0003679
a group of hypodermal cells that lie along the apical midline of the hypodermis, at the extreme left and right sides between nose and tail seam cell lateral hypodermis WBbt:0005753
the most extensive region of neuropil in the animal, consists of a large toroidal bundle of processes. nerve ring circumpharyngeal nerve ring WBbt:0006749
a bundle of nerve processes that runs along the dorsal mid-line of the animal. dorsal nerve cord dorsal cord WBbt:0006750
neuron of phasmid sensillum phasmid neuron   WBbt:0006753
neuron of the amphid sensillum amphid neuron amphid sensory neuron WBbt:0005394
nerve cord positioned at the lateral flanks of the animal, consists of processes of the neuron classes BDU, CAN, PVD and ALA. lateral nerve cord   WBbt:0006769
  reproductive system   WBbt:0005747

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00009920 abts-1 F52B5.1 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023