WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: pharynx; Reproductive System; vulval muscle; Larval Expression: pharynx; Primary Identifier  Expr6805
Remark  Also expressed in (comments from author) : Embryo incomplete. To be updated. Strain: BC10836 Reporter Gene  [ccb-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCTAACCAATCTTTCACTTGCC] 3' and primer B 5' [TGCGGAAAGCCATCTAGC] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

3 Anatomy Terms

Definition Name Synonym Primary Identifier
muscle associated with hermaphrodite vulva. vulval muscle   WBbt:0005821
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine. pharynx esophagus WBbt:0003681
  reproductive system   WBbt:0005747

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00000368 ccb-1 T28F2.5 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023