WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: Nervous System; tail neurons; unidentified cells in tail ; Primary Identifier  Expr6784
Remark  Also expressed in (comments from author) : Unsure if expression is in the larval stage. Only detected GFP in adult tails.Looked at the strain a year later, and saw no expression. Strain: BC11868 Reporter Gene  [T27A8.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTGACGGAGAAGGCTGG] 3' and primer B 5' [ATACGTGATGGTAGCTGAAAATGA] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

3 Anatomy Terms

Definition Name Synonym Primary Identifier
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities. nervous system   WBbt:0005735
neuron with its cell body situated in the tail, posterior to rectum. tail neuron   WBbt:0006759
posterior region, from rectum to the end tail   WBbt:0005741

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00012074 T27A8.2 T27A8.2 Caenorhabditis elegans

1 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041