WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: Reproductive System; vulval muscle; Nervous System; ventral nerve cord; head neurons; neurons along body; tail neurons; Primary Identifier  Expr6480
Remark  Also expressed in (comments from author) : incomplete. Will be updated. Strain: BC10340 Reporter Gene  [R07G3.8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TCAGTTGGATTTCCCTTTCCT] 3' and primer B 5' [TTCTGCGAATCATTAAGCTGAG] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

7 Anatomy Terms

Definition Name Synonym Primary Identifier
neuron with cell body associated with the ventral nerve cord. ventral cord neuron ventral cord motoneuron WBbt:0005300
muscle associated with hermaphrodite vulva. vulval muscle   WBbt:0005821
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities. nervous system   WBbt:0005735
neuron with its cell body situated in the head, excluding the pharynx. head neuron   WBbt:0006751
neuron with its cell body situated in the tail, posterior to rectum. tail neuron   WBbt:0006759
Major cell type of nervous tissue, specialized for transmission of information in the form of patterns of impulses. neuron neurone WBbt:0003679
  reproductive system   WBbt:0005747

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00019944 R07G3.8 R07G3.8 Caenorhabditis elegans

1 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041