WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: body wall muscle; Larval Expression: body wall muscle; Primary Identifier  Expr6582
Remark  Also expressed in (comments from author) : Mosaic population. Strain: BC11369 Reporter Gene  [T03G6.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGTTCCGCAATCAGATTCAT] 3' and primer B 5' [TGGAAATGAGCAGATAAATGGTAA] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

1 Anatomy Terms

Definition Name Synonym Primary Identifier
Longitudinal bands of muscle cells surrounding animal body, with one band running in each quadrant of the body, regulated contraction and relaxation of these muscles cause locomotion. body wall musculature body muscle WBbt:0005813

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00020195 T03G6.3 T03G6.3 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023