WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: Reproductive System; gonad sheath cells; hypodermis; Larval Expression: hypodermis; Primary Identifier  Expr5784
Remark  Strain: BC12531 Reporter Gene  [twk-6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AATGTGAAAACGAAAAACTGACAA] 3' and primer B 5' [TGCAATTTTAGAATCAACTGAACA] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

3 Anatomy Terms

Definition Name Synonym Primary Identifier
Epidermal layer. hypodermis epidermis WBbt:0005733
five pairs of thin gonadal sheath cells form a single layer covering the germ line component of each arm, each pair occupying a stereotyped position along the gonad proximal-distal axis. gonadal sheath cell   WBbt:0005828
  reproductive system   WBbt:0005747

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00006661 twk-6 F17C8.5 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023