WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: Reproductive System; uterus; Nervous System; nerve ring; head neurons; pharyngeal neurons; Larval Expression: pharyngeal gland cells; Reproductive System; developing uterus; Nervous System; nerve ring; ventral nerve cord; head neurons; pharyngeal neurons; unidentified cells in head; unidentified cells in tail ; Primary Identifier  Expr5942
Remark  Also expressed in (comments from author) : High intensity GFP in L1s, decreases in later stages. Mosaic population. Strain: BC11495 Reporter Gene  [dog-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CATGCCTCTTCAGAGATTTCG] 3' and primer B 5' [TGGATCGCTTGAGGACATAA] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

10 Anatomy Terms

Definition Name Synonym Primary Identifier
neuron with cell body associated with the ventral nerve cord. ventral cord neuron ventral cord motoneuron WBbt:0005300
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities. nervous system   WBbt:0005735
neuron with its cell body situated in the head, excluding the pharynx. head neuron   WBbt:0006751
The organ in which the eggs are developed and protected until laid. uterus   WBbt:0006760
neuron of the pharyngeal nervous system. pharyngeal neuron   WBbt:0005439
the most extensive region of neuropil in the animal, consists of a large toroidal bundle of processes. nerve ring circumpharyngeal nerve ring WBbt:0006749
Secretory gland cell of the pharynx Pharyngeal gland cell   WBbt:0005788
posterior region, from rectum to the end tail   WBbt:0005741
anterior-most body region containing the pharynx. head   WBbt:0005739
  reproductive system   WBbt:0005747

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00001049 dog-1 F33H2.1 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023