WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: Reproductive System; vulval muscle; seam cells; Nervous System; head neurons; unidentified cells in head; unidentified cells in tail ; Larval Expression: seam cells; Nervous System; head neurons; unidentified cells in head; unidentified cells in tail ; Primary Identifier  Expr5063
Remark  Strain: BC11586 Reporter Gene  [B0395.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTCGGTCCTCGAACTATTCTTTT] 3' and primer B 5' [GTCTATGGAACCGATTGTTGAAA] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

7 Anatomy Terms

Definition Name Synonym Primary Identifier
muscle associated with hermaphrodite vulva. vulval muscle   WBbt:0005821
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities. nervous system   WBbt:0005735
neuron with its cell body situated in the head, excluding the pharynx. head neuron   WBbt:0006751
a group of hypodermal cells that lie along the apical midline of the hypodermis, at the extreme left and right sides between nose and tail seam cell lateral hypodermis WBbt:0005753
posterior region, from rectum to the end tail   WBbt:0005741
anterior-most body region containing the pharynx. head   WBbt:0005739
  reproductive system   WBbt:0005747

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00007174 mboa-1 B0395.2 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023