WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: Nervous System; nerve ring; ventral nerve cord; lateral nerve cords; head neurons; amphids; neurons along body; tail neurons; unidentified cells in head; Larval Expression: Nervous System; nerve ring; ventral nerve cord; lateral nerve cords; head neurons; amphids; neurons along body; tail neurons; unidentified cells in head; Primary Identifier  Expr5521
Remark  Also expressed in (comments from author) : Embryo incomplete. To be updated. Strain: BC12012 Reporter Gene  [C47A10.6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CATTCTGCCAAAACAAGGAAA] 3' and primer B 5' [CCTGGGAGCCAGTGATTCT] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

9 Anatomy Terms

Definition Name Synonym Primary Identifier
neuron with cell body associated with the ventral nerve cord. ventral cord neuron ventral cord motoneuron WBbt:0005300
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities. nervous system   WBbt:0005735
neuron with its cell body situated in the head, excluding the pharynx. head neuron   WBbt:0006751
neuron with its cell body situated in the tail, posterior to rectum. tail neuron   WBbt:0006759
Major cell type of nervous tissue, specialized for transmission of information in the form of patterns of impulses. neuron neurone WBbt:0003679
the most extensive region of neuropil in the animal, consists of a large toroidal bundle of processes. nerve ring circumpharyngeal nerve ring WBbt:0006749
neuron of the amphid sensillum amphid neuron amphid sensory neuron WBbt:0005394
anterior-most body region containing the pharynx. head   WBbt:0005739
nerve cord positioned at the lateral flanks of the animal, consists of processes of the neuron classes BDU, CAN, PVD and ALA. lateral nerve cord   WBbt:0006769

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00008128 srab-12 C47A10.6 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023