|
Also expressed in (comments from author) : IL1 + IL2 labial neurons (Thomas Lab 2005). Good expression. Strain: BC12597 |
[C47A10.6::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CATTCTGCCAAAACAAGGAAA] 3' and primer B 5' [CCTGGGAGCCAGTGATTCT] 3'. |
Expr5523
|
Adult Expression: Nervous System; head neurons; amphids; labial sensilla; neurons along body; tail neurons; phasmids; Larval Expression: Nervous System; head neurons; amphids; labial sensilla; neurons along body; tail neurons; phasmids; |
|
|
Also expressed in (comments from author) : possibly labial sensillia in head. Hard to see because GFP in other tissues is masking things. Strain: BC12796 |
[arf-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCCCGTTTATTATTGTTGCCTAT] 3' and primer B 5' [CCGAACACGTTTCCGATT] 3'. |
Expr5055
|
Adult Expression: pharynx; intestine; stomato-intestinal muscle; anal depressor muscle; rectal epithelium; Reproductive System; distal tip cell; vulva other; spermatheca; gonad sheath cells; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; labial sensilla; neurons along body; tail neurons; Larval Expression: pharynx; intestine; stomato-intestinal muscle; body wall muscle; Nervous System; head neurons; labial sensilla; tail neurons; |
|
|
Also expressed in (comments from author) : neural in head may be the Labial Sensilla. Strain shows high intensity GFP, therefore anything neural can be hard to see. Strain: BC10655 |
[B0336.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ATATCAATGAAAACGGTCAATGG] 3' and primer B 5' [ATTGTCGATGTGGATGCTTTC] 3'. |
Expr5056
|
Adult Expression: pharynx; pharyngeal gland cells; intestine; stomato-intestinal muscle; anal depressor muscle; anal sphincter; Reproductive System; uterine-seam cell; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; head neurons; labial sensilla; tail neurons; unidentified cells in tail ; Larval Expression: pharynx; pharyngeal gland cells; intestine; stomato-intestinal muscle; anal depressor muscle; anal sphincter; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; head neurons; labial sensilla; tail neurons; unidentified cells in tail ; |
|
|
Also expressed in (comments from author) : head neurons are possibly the Labial Sensilla Strain: BC15645 |
[B0285.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [ACGACACATTGCAAAAACTTCTTA] 3' and primer B 5' [CGATATTTCGATGGCTGAAAA] 3'. |
Expr5038
|
Adult Expression: arcade cells; intestine; rectal gland cells; hypodermis; Nervous System; head neurons; labial sensilla; unidentified cells in head; Larval Expression: arcade cells; intestine; rectal gland cells; hypodermis; Nervous System; head neurons; labial sensilla; unidentified cells in head; |
|
|
Also expressed in (comments from author) : unidentified cells in head, possibly labial sensilla. Strain: DM12747 |
[set-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTACGCTCATCAGGCAGTAGTTT] 3' and primer B 5' [CCTTCGAGTGACACCGCT] 3'. |
Expr6774
|
Adult Expression: pharynx; arcade cells; intestine; Reproductive System; vulval muscle; vulva other; hypodermis; seam cells; Nervous System; head neurons; labial sensilla; unidentified cells in head; Larval Expression: arcade cells; intestine; Reproductive System; developing vulva; hypodermis; seam cells; Nervous System; head neurons; labial sensilla; unidentified cells in head; |
|
|
Also expressed in (comments from author) : Embryo incomplete. To be updated. Strain: BC12021 |
[srg-5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCGGTATTTCTGACAGAGACTCA] 3' and primer B 5' [TTCAAATTCTCAGGCAAAGGA] 3'. |
Expr6678
|
Adult Expression: Nervous System; labial sensilla; Larval Expression: Nervous System; labial sensilla; |
|
|
Reference: personal communication from Oliver Hobert 2002-12-07. |
|
Expr1765
|
Neuronal expression in: labial sensory neurons + sheath & socket Non-neuronal expression in: pharynx; lateral hypoderm. |
|
|
Also expressed in (comments from author) : Neural expression looks like the inner or outer labial sensilla. Larvae have more GFP than adults.Embryo incomplete. To be updated. Strain: BC15005 |
[Y111B2A.8::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AACATCGAAATTTTTGGTTTGG] 3' and primer B 5' [TTGTGAGCCTTGATGAATAAAGAA] 3'. |
Expr6887
|
Adult Expression: Nervous System; head neurons; labial sensilla; Larval Expression: Nervous System; head neurons; labial sensilla; |
|
|
|
|
Expr11158
|
ncx-4 is expressed in AWC, ASE, two pair of labial neurons, ventral/dorsal nerve cord and commissures, faint expression in one pair of non-dye filling posterior neurons. |
|
|
|
|
Expr977
|
Neither immunoblotting nor immunostaining analysis with the anti-EAT-20 polyclonal antibody detected any signal in eat-20 mutants. At the 16-cell stage, patches of staining on the entire surface of embryos were first detected. From the comma stage on, staining was detected in coelomocytes, the nervous tissues, hypodermal cells, and the pharynx. At the comma stage, the apical surface of the alimentary canal was stained intensely and the basal surface of presumptive pharynx was moderately stained. The staining in the presumptive pharynx gradually weakened thereafter and disappeared completely at the late 3-fold stage. The staining of the apical surface of the pharynx and pharyngeal intestinal valve remained intense throughout the rest of the embryogenesis stage. Granular staining in the region surrounding the pharyngeal lumen was observed from the L2 stage on and spread to the external surface. Staining of the entire surface of the pharyngeal muscle was observed in the late L3 or L4 stage. The inner linings of the intestine and anus were intensely stained until the 2-fold stage, and then the staining became weak and disappeared completely at the 3-fold stage. The anterior-most intestinal cell became stained from the L3 stage. Staining was also observed in the nervous tissues. At the rostral end of the head, staining that seemed to correspond to the distal segments of labial process bundles was seen from the comma stage up to the adult stage. In larvae, the staining sometimes extended posteriorly to the level of the isthmus. A pair of cells, which might be support cells of sensory neurons posterior to the distal structures, were stained from the L1 stage up to the adult stage. The motor neurons in the ventral cord, which sometimes expressed GFP in the promoter trap line, were stained at the early L1 stage. This staining disappeared at the late L1 stage and, in the later stages, was replaced by segmental staining of the ventral nerve cord. The nerve ring and the nerve bundles that connect the nerve ring and the ventral nerve cord had dots of very faint staining. On the lateral body wall at the base of the tail spike, staining was detected from the L2 stage up to the adult stage, which may correspond to the axon of ALN neuron that expressed reporter GFP in the promoter trap lines. In the adult male tail, sensory rays were intensely stained. There was also extensive hypodermal staining. Weak staining of the seam cells began at the 3-fold stage and the staining became intense from the L3 stage up to the adult stage. Thin longitudinal bands were stained along the dorsal and ventral midline from the rostral end of the body to the base of the tail spike, which corresponds to the position of the dorsal and ventral hypodermal ridges. The hypodermal staining co-localizing with the position of the ventral nerve cord was the most intense. The hypodermal cells at the opening and inside of the vulva were stained from the L4 stage up to the adult stage. The hypodermis around the anus was stained from the L2 stage up to the adult stage. The coelomocytes were continuously stained from the comma stage up to the adult stage. |
|
|
|
|
Expr10193
|
Strong expression of bus-18 was observed in the rectal epithelial cells, but in addition wide-spread expression was observed in other epithelial cells. General expression in the hypodermis and vulva was observed, as well as in the labial support and arcade cells in the head, the excretory gland cell, the spermatheca, and the phasmid socket and sheath cells. |
|
|
|
|
Expr2401
|
In addition to hindgut cells, lin-48::gfp is expressed in the excretory duct cell, neuronal support cells of the phasmid and labial sensory structures and a small number of additional unidentified cells in the head. In the hindgut, these transgenes are expressed in U, F, K' and K cells. Male animals exhibit additional expression in the developing tail structures. lin-48::gfp expression is initiated in late embryogenesis and persists into adulthood. |
The chimeric LIN-48::GFP protein is localized to the nuclei of expressing cells. |
