WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Expression Pattern :

Pattern  Adult Expression: pharynx; vulval muscle; Nervous System; lateral nerve cords; head neurons; pharyngeal neurons; tail neurons; Larval Expression: pharynx; Nervous System; lateral nerve cords; head neurons; pharyngeal neurons; tail neurons; Primary Identifier  Expr5193
Remark  Strain: BC14658 Reporter Gene  [clp-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTCAGTGTCTATTTGTTTGTTGCC] 3' and primer B 5' [GTCGGCTTTTGCTGTGAAA] 3'.
Paste the following link
Lists
This ExpressionPattern isn't in any lists. Upload a list.

7 Anatomy Terms

Definition Name Synonym Primary Identifier
muscle associated with hermaphrodite vulva. vulval muscle   WBbt:0005821
the feeding organ, a neuro-muscular pump in the head of the animal, used to ingest food, bacteria suspended in liquid, filter them out, grind them up and transport posteriorly into the instestine. pharynx esophagus WBbt:0003681
Complement of nervous tissue (neurones, nerves, receptors and support cells) serving to detect, relay and coordinate information about an animal`s internal and external environments and to initiate and integrate its effector responses and activities. nervous system   WBbt:0005735
neuron with its cell body situated in the head, excluding the pharynx. head neuron   WBbt:0006751
neuron with its cell body situated in the tail, posterior to rectum. tail neuron   WBbt:0006759
neuron of the pharyngeal nervous system. pharyngeal neuron   WBbt:0005439
nerve cord positioned at the lateral flanks of the animal, consists of processes of the neuron classes BDU, CAN, PVD and ALA. lateral nerve cord   WBbt:0006769

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00000542 clp-1 C06G4.2 Caenorhabditis elegans

2 Life Stages

Remark Definition Other Name Public Name Primary Identifier
  The stage that begins when a C.elegans individual is fully-developed and has reached maturity. adult Ce WBls:0000041
  A developmental life stage of the nematode Caenorhabditis elegans that occurs from egg hatching until adulthood. larva Ce WBls:0000023