WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Strain :

WormBase ID  WBStrain00062618 CGC Received  2024-12-17
Genotype  chil-11(bet66) IV. Laboratory  CGC
Mutagen  CRISPR_Cas9 Name  JCB426
Outcrossed  x2 Remark  Homozygous viable. Deletion of 2532 bp in parental strain N2. Left flanking sequence: agtcaattcggaactccatgt; Right flanking sequence: tctacggtttaaacaactcctc. sgRNA #1: aacgggatctgttcatcaca; sgRNA #2: agtgtgaaacgcaacgtcta.
Species  Caenorhabditis elegans
Paste the following link
Lists
This Strain isn't in any lists. Upload a list.

0 Alleles

1 Data Sets

Name URL
WormBaseAcedbConverter  

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00016665 chil-11 C45E5.2 Caenorhabditis elegans