1 Genes
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00004879 | smg-1 | C48B6.6 | Caenorhabditis elegans |
| WormBase ID | WBStrain00058292 | CGC Received | 2023-10-23 |
| Genotype | smg-1(cc546) I; xchEx91. | Laboratory | LSD |
| Name | LSD1091 | Outcrossed | x0 |
| Remark | xchEx91 [hsp-16.2p::ssSel1::FLAG::superfolderGFP::spacer::humanAmyloidBeta1-42(F20S/L35P)::let-858 3UTR + rol-6(su1006)]. Maintain at 15C. Pick Rollers to maintain. Control strain for LSD2104. Upon heat shock, non-sticky form of human amyloid beta is expressed and secreted into the extracellular space. Reference: Jongsma E, et al. eLife. 2023 Sep 20;12:e83465. doi: 10.7554/eLife.83465. PMID: 37728486. [NOTE: The temperature-sensitive allele cc546 causes an M1957L change in SMG-1. The lesion is an atg>ttg transversion in exon 35. Flanking sequences follow with the mutation site indicated with a capital A: ttggtggtcggttacaaaacgatattcaaga tcactggcagtcatgagtAtggttggatcagttttaggactcggtgatcg acatttggacaatttattg The lesion is detectable via SNP-snip with the mutation causing loss of an MslI site. Primers are for a 323 bp product. Digest with MslI to 86+237 in the wild type, uncut as 323 in the mutant. DJR701(f): CAGTCGTGAGCTTTGGATGCGTGC DJR702(r): TCGGGGATACGCAGATTCTTTCCC. Pedone ... Reiner G3 (2021).] | Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00004879 | smg-1 | C48B6.6 | Caenorhabditis elegans |
Powered by
