WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Strain :

WormBase ID  WBStrain00055222 CGC Received  2022-06-15
Genotype  pals-26(sy1228) III. Laboratory  CGC
Mutagen  CRISPR_Cas9 Name  PS8221
Outcrossed  x0 Remark  Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of pals-26. Universal 43 bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). left flanking sequence: CATTGCTCAAGACATGCGAAATAACATGCAACCTGAA right flanking sequence: CGTGAGCGCCGGCAAAGGGAGCTTGAAGCTTTAG Inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA: CTTTGCCGGCGCTCACGTTC Method Reference: G3 (Bethesda).2018 Nov 6;8(11):3607-3616
Species  Caenorhabditis elegans
Paste the following link
Lists
This Strain isn't in any lists. Upload a list.

1 Alleles

Public Name
sy1228

1 Data Sets

Name URL
WormBaseAcedbConverter  

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00007131 pals-26 B0284.1 Caenorhabditis elegans