1 Genes
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00000240 | pah-1 | K08F8.4 | Caenorhabditis elegans |
| WormBase ID | WBStrain00055119 | CGC Received | 2022-05-25 |
| Genotype | pah-1(syb3601) II. | Laboratory | CGC |
| Name | PHX3601 | Outcrossed | x0 |
| Remark | Superficially wild-type; decreased production of serotonin-derived metabolites; increase in exploration. CRISPR-mediated deletion removing 1450 bp spans Exon 1 to Exon 6. Upstream flanking sequence: cctctgaaaaccaaatcttgttctctgaaa; Downstream flanking sequence: TCGCTGGTCTTCTTTCTTCTCGTGATTTCT. | Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00000240 | pah-1 | K08F8.4 | Caenorhabditis elegans |
Powered by
