| WormBase ID | WBStrain00055485 | CGC Received | 2023-04-18 |
| Genotype | xpd-1(ve842[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/sC1(s2023) [dpy-1(s2170) umnIs41] II. | Laboratory | CGC |
| Mutagen | CRISPR_Cas9 | Name | RG3342 |
| Remark | umnIs41 [myo-2p::mKate2 + NeoR, III: 518034 (intergenic)] III. Late larval arrest. Deletion of 11823 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, GFP+ non-mKate2 arrested larvae (ve842 homozygotes), Dpy non-GFP mKate2+ (sC1 homozygotes). Maintain by picking wild-type GFP+ mKate2+. [NOTE: xpd-1 is located near the end of the region of LG III balanced by sC1, thus not known if truly balanced by sC1.] Left flanking Sequence: CCGGATAAGCTTGATAAGCTTGTCTATTGT; Right flanking sequence: AGTTATTACGCTATCATGTCATGATGCTTC. xpd-1 sgRNA #1: TCCAGAACTATTCCAGGTAG; xpd-1 sgRNA #2: GCCAGTTGACTACCATCCTG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation. | Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00001063 | dpy-1 | M01E10.2 | Caenorhabditis elegans |
| WBGene00003514 | myo-2 | T18D3.4 | Caenorhabditis elegans |
| WBGene00004496 | rps-27 | F56E10.4 | Caenorhabditis elegans |
| WBGene00006789 | unc-54 | F11C3.3 | Caenorhabditis elegans |
| WBGene00021752 | xpd-1 | Y50D7A.2 | Caenorhabditis elegans |
Powered by
