WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Strain :

WormBase ID  WBStrain00054542 CGC Received  2023-06-02
Genotype  cec-8(fj63) III; cec-4(ok3124) cec-5(fj58) IV. Laboratory  ZT
Made By  WBPerson1503 Mutagen  CRISPR_Cas9
Name  ZT34 Outcrossed  x1
Remark  Maintain at 20C or lower. cec-8; cec-4 cec-5 triple mutants exhibit partial sterility and no significant defects in chromosome segregation. The chromodomain proteins CEC-5, CEC-4, and CEC-8 are phylogenetically similar to each other. The deletions can be detected by PCR with the following primers: cec-8(fj63): GCTGTATAATACTCACTATGTC and TCCAGCTCTGTAACCTTGAA; cec-4(ok3124): CAATTAAAATGCCAGTGCGA and TTTAGGATGCATTATGGGGC; cec-5(fj58): GCAAAGAAATCATCCGGTAGTG and CTTTGTAGCAACAGGCTCCTC. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002. Species  Caenorhabditis elegans
Paste the following link
Lists
This Strain isn't in any lists. Upload a list.

3 Alleles

Public Name
ok3124
fj58
fj63

1 Data Sets

Name URL
WormBaseAcedbConverter  

3 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00017990 cec-4 F32E10.2 Caenorhabditis elegans
WBGene00017993 cec-5 F32E10.6 Caenorhabditis elegans
WBGene00021913 cec-8 Y55B1BR.3 Caenorhabditis elegans