1 Genes
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00001187 | egl-19 | C48A7.1 | Caenorhabditis elegans |
| WormBase ID | WBStrain00052850 | CGC Received | 2023-01-10 |
| Genotype | egl-19(utx45[egl-19(A&B)::mScarlet-I-C1::3xMyc] IV. | Laboratory | GLW |
| Mutagen | CRISPR_Cas9 | Name | GLW53 |
| Outcrossed | x0 | Remark | [2023-06-29T19:05:01.936Z WBPerson712] New Strain: WBPaper00065588 GLW53 egl-19(utx45[egl-19(ab1-33)::mScarlet::3xMyc::egl-19(ab34-)] IV Referred to herein as mScarlet::EGL-19(ab). Internal mScarlet tag at the 5 end of exon 3 that tags isoforms a and b. The insertion was verified by PCR and fluorescence. Left flank: 5 ttatttgaatgagcaaaaaataaatttcag 3; Right flank: 5' GCCGCAGTGGCAGCTTCATCATCACAAGAT 3 (1 silent mutation); gRNA: TTGTGATGATGAAGCTGCCA; Cas9/sgRNA plasmid: pGLOW69; mScarlet^SEC^3xMyc plasmid: pGLOW60. Strain available from the CGC. |
| Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00001187 | egl-19 | C48A7.1 | Caenorhabditis elegans |
Powered by
