WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Strain :

WormBase ID  WBStrain00051808 CGC Received  2021-11-30
Genotype  mod-5(vlc47[mod-5::T2A::mNeonGreen]) I. Laboratory  CGC
Name  NFB1719 Outcrossed  x0
Remark  mNeonGreen tag inserted into endogenous mod-5 locus. Upstream flanking sequence: AAATTATCGATAGTTCTCTTTTAGATCCAATcCAcACtCTcACaCCAGTT. Downstream flanking sequence: TAGATAATTCTTGGTGTACTGTTGGAAGTCAACGATCGATAGCCGTGCAC. Guide sequence: ACTGGAGTAAGTGTATGAAT. Reference: Maicas et al. PLOS Biology 2021; 19(7): e3001334. DOI: 10.1371/journal.pbio.3001334 Species  Caenorhabditis elegans
Paste the following link
Lists
This Strain isn't in any lists. Upload a list.

0 Alleles

1 Data Sets

Name URL
WormBaseAcedbConverter  

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00003387 mod-5 Y54E10BR.7 Caenorhabditis elegans