WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Strain :

WormBase ID  WBStrain00050918 CGC Received  2021-02-18
Genotype  oac-52(sy1290) IV. Laboratory  CGC
Mutagen  CRISPR_Cas9 Name  PS8394
Outcrossed  xNo Remark  Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of oac-52; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).Left flanking sequence: CTTCAAGGTATTCGAGGTCTTGCTATTACAGTTGTRight flanking sequence: ACTAGGTTTTCATTTCTATCCAGAAGCTTTTCCCinserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : CTTGCTATTACAGTTGTACTMethod Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616
Species  Caenorhabditis elegans
Paste the following link
Lists
This Strain isn't in any lists. Upload a list.

1 Alleles

Public Name
sy1290

1 Data Sets

Name URL
WormBaseAcedbConverter  

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00020977 oac-52 W03B1.8 Caenorhabditis elegans