1 Genes
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00003746 | nlp-8 | D2005.2 | Caenorhabditis elegans |
| WormBase ID | WBStrain00050711 | CGC Received | 2021-03-22 |
| Genotype | nlp-8(syb762) IV. | Laboratory | CGC |
| Mutagen | CRISPR_Cas9 | Name | HBR2317 |
| Outcrossed | x1 | Remark | syb762 is a 1076 bp deletion in nlp-8. Flanking sequences: taaaacccggaacc - acttcttgaacaactg Forward primer: TAAAAGCGGAGTAGCGTCCA Reverse primer: CAGATGGTCGGGTGATTTGA syb762 was generated in a mutant background and out-crossed to N2 to remove those background mutations. Reference: Sinner MP, et al. Curr Biol. 2021 Feb 8;31(3):564-577.e12. PMID: 33259791 |
| Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00003746 | nlp-8 | D2005.2 | Caenorhabditis elegans |
Powered by
