1 Genes
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00014235 | ZK1225.1 | ZK1225.1 | Caenorhabditis elegans |
| WormBase ID | WBStrain00047575 | CGC Received | 2019-11-05 |
| Genotype | ZK1225.1(gk5216) I. | Laboratory | CGC |
| Mutagen | EMS | Name | VC4134 |
| Outcrossed | x0 | Remark | Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5216 mutation is C->T, flanking sequences AAATACACTCTGGAATCATACGCATCAATT and GAAGATATTATCCTACCAACAAGTTTATTA. |
| Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00014235 | ZK1225.1 | ZK1225.1 | Caenorhabditis elegans |
Powered by
