1 Genes
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00010221 | F57G12.1 | F57G12.1 | Caenorhabditis elegans |
| WormBase ID | WBStrain00047570 | CGC Received | 2019-11-05 |
| Genotype | F57G12.1(gk5196) X. | Laboratory | CGC |
| Mutagen | EMS | Name | VC4117 |
| Outcrossed | x0 | Remark | Homozygous viable. Nonsense allele identified by amplicon sequencing. The gk5194 mutation is A->T, flanking sequences CTCTTTGCGTGGTCTCTGACGCTCGGTTGG and TAATCGATGATCACCTGGCGTGTGAAAGGC. |
| Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00010221 | F57G12.1 | F57G12.1 | Caenorhabditis elegans |
Powered by
