WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Strain :

WormBase ID  WBStrain00047225 CGC Received  2019-11-12
Genotype  sftb-1(cer114[mCherry::sftb-1]) III. Laboratory  CGC
Mutagen  CRISPR_Cas9 Name  CER444
Outcrossed  x0 Remark  Endogenous sftb-1 reporter generated by CRISPR/Cas9 using the Nested CRISPR protocol (Vicencio et al., 2019 Genetics). mCherry was amplified from pJJR83 plasmid and inserted at the 5' end of the sftb-1 gene. External primers used for genotyping: (For: AGCTATCGAAGTTTAGGATGTTGTT) (Rev: CGGTTCCAATCGAGTCTAGGTA) Reference: Serrat X, et al. PLoS Genet. 2019 Oct 21;15(10):e1008464.
Species  Caenorhabditis elegans
Paste the following link
Lists
This Strain isn't in any lists. Upload a list.

1 Alleles

Public Name
cer114

1 Data Sets

Name URL
WormBaseAcedbConverter  

1 Genes

WormBase Gene ID Gene Name Sequence Name Organism
WBGene00011605 sftb-1 T08A11.2 Caenorhabditis elegans