| WormBase ID | WBStrain00033365 | CGC Received | 2019-04-29 |
| Genotype | spe-36(ve539[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/nT1[umnIs49] IV; +/nT1 V. | Laboratory | CGC |
| Made By | WBPerson14989 | Mutagen | CRISPR_Cas9 |
| Name | RG3039 | Remark | Superficially wild-type. CRISPR/Cas9 deletion of F40F11.4. Insertion site verified by PCR. umnIs49 [myo-2p::mKate2 + NeoR, V: 1005689 (intergenic)] IV. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, ve539 homozygotes (Ste, lays only oocytes, GFP+ mKate-), Vul nT1 homozygotes (brighter mKate2+) and dead eggs. Maintain by picking wild-type GFP+ mKate2+. myo-2p::GFP + NeoR cassette is still present but may be excised using LoxP sites. Left flanking sequence: aaaactcacAAATAACTTTGTACCG Right flanking sequence: ACGCAAGAGCTATGAAGAACAGAAT |
| Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00003514 | myo-2 | T18D3.4 | Caenorhabditis elegans |
| WBGene00004496 | rps-27 | F56E10.4 | Caenorhabditis elegans |
| WBGene00006789 | unc-54 | F11C3.3 | Caenorhabditis elegans |
| WBGene00009589 | spe-36 | F40F11.4 | Caenorhabditis elegans |
Powered by
