WormMine

WSWS298

An integrated data resource for C. elegans and related nematodes

Gene :

WormBase Gene ID  ? WBGene00123557 Gene Name  Cjp-igdb-3
Sequence Name  ? CJA04353 Organism  Caenorhabditis japonica
Automated Description  Is predicted to encode a protein with the following domains: DB module; Domain of unknown function DB; Fibronectin type III superfamily; Fibronectin type III domain; Immunoglobulin-like fold; Immunoglobulin-like domain superfamily; and Fibronectin type III. Is an ortholog of C. elegans igdb-3. Biotype  SO:0001217
Genetic Position  :±
Paste the following link
Quick Links:
SummaryGenomicsOther
 
Quick Links:
SummaryGenomicsOther
 
Lists
This Gene isn't in any lists. Upload a list.

1 Organism

Name Taxon Id
Caenorhabditis japonica 281687

0 Synonyms

Genomics

2 Transcripts

WormMine ID Sequence Name Length (nt) Chromosome Location
Transcript:CJA04353b.1 CJA04353b.1   [unknown]
Transcript:CJA04353c.1 CJA04353c.1   [unknown]
 

Other

2 CDSs

WormMine ID Sequence Name Length (nt) Chromosome Location
CDS:CJA04353c CJA04353c   [unknown]
CDS:CJA04353b CJA04353b   [unknown]

0 RNAi Result

0 Allele

0 Chromosome

0 Chromosome Location

1 Data Sets

Name URL
WormBaseAcedbConverter  

0 Downstream Intergenic Region

0 Expression Clusters

1 Expression Patterns

Remark Reporter Gene Primary Identifier Pattern Subcellular Localization
CJA04353, GCTGAGATTGGAAAGCTCTTCAAATGTACTGCCAGTGAATTGAACAGTTCTGGATGCTGC, WBGene00123557   Expr1072309 Developmental gene expression time-course. Raw data can be downloaded from ftp://caltech.wormbase.org/pub/wormbase/datasets-published/levin2012  

0 GO Annotation

0 Homologues

0 Locations

0 Ontology Annotations

0 Regulates Expr Cluster

0 Sequence

1 Sequence Ontology Term

Identifier Name Description
gene  

0 Strains

0 Upstream Intergenic Region