2 Genes
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00045329 | mir-795 | F33E2.9 | Caenorhabditis elegans |
| WBGene00045328 | mir-794 | T07D10.7 | Caenorhabditis elegans |
| WormBase ID | WBStrain00040304 | CGC Received | 2018-02-21 |
| Genotype | mir-794 mir-795(maDf5) I. | Laboratory | CGC |
| Made By | WBPerson22864 | Mutagen | CRISPR_Cas9 |
| Name | VT3301 | Outcrossed | x2 |
| Remark | mir-794 mir-795(maDf5) enhances retarded phenotypes of mir-48 mir-241 (nDF51). maDf5 allele is missing the 1312 nucleotide region between ATACATATTCCGAGAAACGTTACCT and GTGAGGCGCCAAATGCCGGCCTCAC [chrI:12,594,556-12,595,917 of WBcel235/ce11]. | Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00045329 | mir-795 | F33E2.9 | Caenorhabditis elegans |
| WBGene00045328 | mir-794 | T07D10.7 | Caenorhabditis elegans |
Powered by
