1 Genes
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00003784 | nos-2 | ZK1127.1 | Caenorhabditis elegans |
| WormBase ID | WBStrain00022439 | CGC Received | 2014-11-11 |
| Genotype | nos-2(ax2033) II. | Laboratory | CGC |
| Mutagen | CRISPR_Cas9 | Name | JH3180 |
| Outcrossed | x0 | Remark | Maintain at 20C. ax2033 was produced by replacing +16 to +42 with TCGACTCTCGAACGATCGTAATAG in the first exon of nos-2. ax2033 mutants are sterile when fed nos-1 dsRNA. Reference: Paix A, et al. Genetics. 2014 Sep 23. |
| Species | Caenorhabditis elegans |
| WormBase Gene ID | Gene Name | Sequence Name | Organism |
|---|---|---|---|
| WBGene00003784 | nos-2 | ZK1127.1 | Caenorhabditis elegans |
Powered by
